D6Mit61 Primer Detail MGI Mouse MGI:707673

D6Mit61 Primer Detail

Name

D6Mit61
Primer 1 Sequence

TACAGAGGCTAGAACACTCCTGG
Primer 2 Sequence

CACTTGTTGCTCCTGCTGAG
ID

MGI:707673
Product Size

132
Other IDs

D6Mit61 (BROAD)
Note

MIT assay: MPC141
Additional information: MIT STS Marker Data Files

D6Mit61

DNA segment, Chr 6, Massachusetts Institute of Technology 61

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit61	a	136bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	b	142bp	CAST/EiJ
	c	146bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
	d	156bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D6Mit61	a	146bp	A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
	b	140bp	BALB/cW
	c	136bp	129/SvW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24