D13Mit24 Primer Detail MGI Mouse MGI:707690

D13Mit24 Primer Detail

Name

D13Mit24
Primer 1 Sequence

TGCATGACTGTGTAATGCTTTG
Primer 2 Sequence

GAAGAACTGGGGAAACTGAGG
ID

MGI:707690
Product Size

172
Other IDs

D13Mit24 (BROAD)
Note

MIT assay: P36
Additional information: MIT STS Marker Data Files

D13Mit24

DNA segment, Chr 13, Massachusetts Institute of Technology 24

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit24	a	166bp	AKR/J, C3H/HeJ, NON/ShiLt
	b	170bp	CAST/EiJ
	c	178bp	SPRET/EiJ
	d	188bp	NOD/MrkTac
	e	196bp	A/J, BALB/cJ, LP/J
	f	206bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit24	c	smaller	CBA/Kw
	D13Mit24	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13