D13Mit23 Primer Detail MGI Mouse MGI:707709

D13Mit23 Primer Detail

Name

D13Mit23
Primer 1 Sequence

GAGAATCTACCACGGCTACCC
Primer 2 Sequence

CCCCAAAGAAATCTTGTCTCA
ID

MGI:707709
Product Size

182
Note

MIT assay: J9

D13Mit23

DNA segment, Chr 13, Massachusetts Institute of Technology 23

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D13Mit23	c	176bp	C3HeB/FeJLe
	D13Mit23	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit23	a	152bp	CAST/EiJ
	b	166bp	SPRET/EiJ
	c	176bp	BALB/cJ, C3H/HeJ, LP/J
	d	180bp	C57BL/6J
	e	182bp	AKR/J, B6.Cg-Lep^ob/+
	f	186bp	DBA/2J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/29/2024 MGI 6.24