D11Mit104 Primer Detail MGI Mouse MGI:707741

D11Mit104 Primer Detail

Name

D11Mit104
Primer 1 Sequence

CACATGATCATACACTGTTTCTCC
Primer 2 Sequence

GCCACGTGTTCTAACCTTCC
ID

MGI:707741
Product Size

159
Other IDs

D11Mit104 (BROAD)
Note

MIT assay: MPC506
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 104

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit104	m	189bp	MOLF/EiJ
Not Specified	D11Mit104	s	172bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit104	a	156bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J
	b	158bp	AKR/J, NOD/MrkTac, NON/ShiLt
	c	162bp	BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	d	166bp	SPRET/EiJ
	e	178bp	CAST/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit104	a	smaller	129P3/J
	D11Mit104	s	larger	SJL/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24