About   Help   FAQ
D3Mit258 Primer Detail
Primers
  • Name
    D3Mit258
  • Primer 1 Sequence
    ACACAGGAATATGGTGTGAGTCC
  • Primer 2 Sequence
    AACAGTAGTAGAGGCAAGTAGTGTTTG
  • ID
    MGI:707752
  • Product Size
    218
  • Other IDs
    D3Mit258 (BROAD)
  • Note
    MIT assay: MT4372
    Additional information: MIT STS Marker Data Files
Genes
D3Mit258 DNA segment, Chr 3, Massachusetts Institute of Technology 258
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit258 a 192bp A/J, BALB/cJ, C3H/HeJ, LP/J
b 217bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NON/ShiLt
c 221bp SPRET/EiJ
d 223bp CAST/EiJ
e 225bp NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D3Mit258 c 192bp 129P3/J, AKR/OlaHsd, BALB/cJ, JF1, PWB, SJL/J
d 220bp A/JOlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory