About   Help   FAQ
D9Mit279 Primer Detail
Primers
  • Name
    D9Mit279
  • Primer 1 Sequence
    CTCCAGAAACTTGTCCGCTC
  • Primer 2 Sequence
    AATTGAAACTGTATCTAAGGCATGG
  • ID
    MGI:707755
  • Product Size
    142
  • Other IDs
    D9Mit279 (BROAD)
  • Note
    MIT assay: MT3132
    Additional information: MIT STS Marker Data Files
Genes
D9Mit279 DNA segment, Chr 9, Massachusetts Institute of Technology 279
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit279 a 136bp A/J, BALB/cJ, C3H/HeJ, LP/J
b 140bp SPRET/EiJ
c 146bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
d 148bp NOD/MrkTac
e 154bp AKR/J, NON/ShiLt
f 158bp CAST/EiJ
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D9Mit279 a larger 129P3/J
s smaller SJL/J
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D9Mit279 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/03/2024
MGI 6.24
The Jackson Laboratory