D9Mit279 Primer Detail MGI Mouse MGI:707755

D9Mit279 Primer Detail

Name

D9Mit279
Primer 1 Sequence

CTCCAGAAACTTGTCCGCTC
Primer 2 Sequence

AATTGAAACTGTATCTAAGGCATGG
ID

MGI:707755
Product Size

142
Other IDs

D9Mit279 (BROAD)
Note

MIT assay: MT3132
Additional information: MIT STS Marker Data Files

D9Mit279

DNA segment, Chr 9, Massachusetts Institute of Technology 279

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit279	a	136bp	A/J, BALB/cJ, C3H/HeJ, LP/J
	b	140bp	SPRET/EiJ
	c	146bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	d	148bp	NOD/MrkTac
	e	154bp	AKR/J, NON/ShiLt
	f	158bp	CAST/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit279	a	larger	129P3/J
	D9Mit279	s	smaller	SJL/J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit279	c	upper	CBA/Kw
	D9Mit279	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24