D9Mit26 Primer Detail MGI Mouse MGI:707768

D9Mit26 Primer Detail

Name

D9Mit26
Primer 1 Sequence

ATTGCATAACACCCCCACAT
Primer 2 Sequence

CAGTGCTTAACTGCTCAAATGC
ID

MGI:707768
Product Size

224
Note

MIT assay: D628

D9Mit26

DNA segment, Chr 9, Massachusetts Institute of Technology 26

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit26	a	210bp	NOD/MrkTac, SPRET/EiJ
	b	218bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NON/ShiLt
	c	224bp	BALB/cJ, CAST/EiJ
	d	230bp	A/J, C3H/HeJ, DBA/2J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit26	c	upper	CBA/Kw
	D9Mit26	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24