D9Mit21 Primer Detail MGI Mouse MGI:707771

D9Mit21 Primer Detail

Name

D9Mit21
Primer 1 Sequence

CAGTCCCTGGTTAATAACAACAAC
Primer 2 Sequence

TATAGTCCATTGTGGCAGAGGAGT
ID

MGI:707771
Product Size

191
Other IDs

D9Mit21 (BROAD)
Note

MIT assay: D15
Additional information: MIT STS Marker Data Files

D9Mit21

DNA segment, Chr 9, Massachusetts Institute of Technology 21

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit21	a	177bp	129X1/Sv
Not Specified	D9Mit21	f	185bp	CD-1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit21	m	178bp	MOLF/EiJ
Not Specified	D9Mit21	s	190bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit21	a	166bp	SPRET/EiJ
	b	177bp	DBA/2J, LP/J, NOD/MrkTac
	c	185bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NON/ShiLt
	d	187bp	AKR/J
	e	205bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24