D9Mit22 Primer Detail MGI Mouse MGI:707772

D9Mit22 Primer Detail

Name

D9Mit22
Primer 1 Sequence

ATTGCATAACACCCCCACAT
Primer 2 Sequence

CAGTGCTTAACTGCTCAAATGC
ID

MGI:707772
Product Size

224
Other IDs

D9Mit22 (BROAD)
Note

MIT assay: d134
Additional information: MIT STS Marker Data Files

D9Mit22

DNA segment, Chr 9, Massachusetts Institute of Technology 22

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit22	a	largest	DBA/2
Not Specified	D9Mit22	b	smaller	C57BL/6, JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit22	a	212bp	SPRET/EiJ
	b	218bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	c	226bp	BALB/cJ
	d	228bp	CAST/EiJ
	e	230bp	A/J, C3H/HeJ, DBA/2J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24