DXMit118 Primer Detail MGI Mouse MGI:707781

DXMit118 Primer Detail

Name

DXMit118
Primer 1 Sequence

AGACTGTCTTTCTTCATAATGTCTGTG
Primer 2 Sequence

TGCTATATTCATAGACTGGTACTGTGC
ID

MGI:707781
Product Size

134
Other IDs

DXMit118 (BROAD)
Note

MIT assay: MT2581
Additional information: MIT STS Marker Data Files

DXMit118

DNA segment, Chr X, Massachusetts Institute of Technology 118

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	DXMit118	a	130bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	136bp	129X1/SvJ
		c	124	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	DXMit118	a	122bp	CAST/EiJ
	DXMit118	b	134bp	B6.Cg-Lep^ob/+

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24