D2Mit355 Primer Detail MGI Mouse MGI:707799

D2Mit355 Primer Detail

Name

D2Mit355
Primer 1 Sequence

GTCTTCCTTTGGGTAGTTCTCG
Primer 2 Sequence

AAATAAATGTCTGCCTCTTTCCC
ID

MGI:707799
Product Size

147
Other IDs

D2Mit355 (BROAD)
Note

MIT assay: MJ4770
Additional information: MIT STS Marker Data Files

D2Mit355

DNA segment, Chr 2, Massachusetts Institute of Technology 355

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit355	a	130bp	SPRET/EiJ
	b	142bp	A/J, AKR/J, NOD/MrkTac, NON/ShiLt
	c	147bp	B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D2Mit355	a	147bp	BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	b	142bp	A.CA/W, AKR/W
	c	138bp	BN/aW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24