About   Help   FAQ
D2Mit2 Primer Detail
Primers
  • Name
    D2Mit2
  • Primer 1 Sequence
    AGTCCTCCTTGGACTTCCATTAG
  • Primer 2 Sequence
    TGGATTATATTTTCAAGACCAGA
  • ID
    MGI:707819
  • Product Size
    126
  • Other IDs
    D2Mit2 (BROAD)
  • Note
    MIT assay: M112
    Additional information: MIT STS Marker Data Files
Genes
D2Mit2 DNA segment, Chr 2, Massachusetts Institute of Technology 2
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit2 c 129bp C3HeB/FeJLe
f larger FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit2 a largest JF1, MSM/Ms
b smaller C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit2 a 129bp A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, CAST/EiJ, DBA/2J, LP/J
b 135bp NOD/MrkTac, NON/ShiLt
c 138bp SPRET/EiJ
d 147bp B6.Cg-Lepob/+
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D2Mit2 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D2Mit2 c 137bp CBA/CaOlaHsd
s 143bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
09/03/2024
MGI 6.24 		The Jackson Laboratory