Tcp10msF, Tcp10msR Primer Detail MGI Mouse MGI:7243

Tcp10msF, Tcp10msR Primer Detail

Name

Tcp10msF, Tcp10msR
Primer 1 Sequence

GCGTGCCCCTTGGACAGGG
Primer 2 Sequence

GCTGTACTGTAACCTTGCTTAG
ID

MGI:7243
Region Covered

intron 1 of the Tcp10b gene
Product Size

250-300bp
Note

This primer pair amplifies microsatellite alleles from the various members of the Tcp10 family.

Tcp10	t-complex protein 10
Tcp10a	t-complex protein 10a
Tcp10b	t-complex protein 10b

J:33200 Ardlie KG, et al., Genet Res. 1996 Feb;67(1):1-10

Gene	Allele	Fragments	Strains
Tcp10	a	293,292bp	129X1/SvJ
	b	298,278bp	C57BL/6
	c	288bp	C3H/He
	d	286,278,276bp	C3.t⁰
	e	286,274,270bp	C3H-t^w2
	f	280,268bp	C3.t¹², STOCK t^w32
	g	294,274,273bp	C3.t^w12
	h	290,278bp	C3.t^w73
	i	294,274,272bp	C3.t^w18
	j	286,276,270bp	STOCK t^Lub3
	k	284,278,270bp	STOCK t^Lub1
	l	288,278,270bp	STOCK t^Lub4, STOCK t^Lub6
	m	286,278bp	STOCK t^Lub8, STOCK t^Tuw24
	n	274,270,258bp	STOCK t^Tuw11
	o	280bp	STOCK t^Tuw32
	p	294,278,272bp	(STOCK T(3;12)58H x 129X1/SvJ)F1, (STOCK T(7;16)67H x 129X1/SvJ)F1, (T(1;2)5Ca x 129X1/SvJ)F1
	q	294,274,272bp	(CF109 x 129X1/SvJ)F1, (STOCK T(2;19)68H x 129X1/SvJ)F1
	r	280,276bp	(BM1 x 129X1/SvJ)F1
	s	280,274,264bp	(PV1 x 129X1/SvJ)F1
	t	286,274bp	(MV1 x 129X1/SvJ)F1
	u	294,274,266bp	C3.t^w5

J:33200 Ardlie KG, et al., Recent evolution of mouse t haplotypes at polymorphic microsatellites associated with the t complex responder (Tcr) locus. Genet Res. 1996 Feb;67(1):1-10

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24