Pgk1-pA, Pgk1-pB Primer Detail MGI Mouse MGI:7247

Pgk1-pA, Pgk1-pB Primer Detail

Name

Pgk1-pA, Pgk1-pB
Primer 1 Sequence

TTCTCCTCTTCCTCATCTCC
Primer 2 Sequence

TAAAGGACACATTTGGTCGC
ID

MGI:7247

Pgk1

phosphoglycerate kinase 1

J:32578 Shanmugam V, et al., Biochem Genet. 1996 Feb;34(1-2):17-29

Endonuclease	Gene	Allele	Fragments	Strains
HpaII/Tth111I	Pgk1	a	345bp	B6.Cg-Pgk1^a/J, CAST/EiJ, MOLF/EiJ, MOLG/DnJ, PWK
HpaII/Tth111I	Pgk1	b	272,73bp	A.SW-H2^s/Sn, BALB/cByJ, C3H, C57BL/6J-Hprt1^a, C57BL/10, CBA/CaHN-Btk^xid/J, FAIYUM-3, M. m. macedonicus, NZB/BlNJ, NZW/LacJ, PL/J, SF/CamEiJ, SK/CamEi, SPRET/EiJ, STU

J:74919 Grzmil P, Personal Communication. 2002;

Endonuclease	Gene	Allele	Fragments	Strains
Tth111l	Pgk1	b	272bp, 73bp	AKR/J, B10.BR-H2^k, DBA/2, KE, KP

J:32578 Shanmugam V, et al., A novel Tth111I restriction fragment length polymorphism (RFLP) allows tracing of X-chromosome inactivation in the (Xid) heterozygote. Biochem Genet. 1996 Feb;34(1-2):17-29

J:74919 Grzmil P, Polymorphism of the Pgk1 gene in mouse. Personal Communication. 2002;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13