T12 Primer Detail MGI Mouse MGI:732

T12 Primer Detail

Name

T12
Primer 1 Sequence

AACTGTTCAAAGCCATTTCG
Primer 2 Sequence

CTATGGACTCACAGCCAGGCT
ID

MGI:732

D11Nds7	DNA segment, Chr 11, Nuffield Department of Surgery 7
Gfap	glial fibrillary acidic protein

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D11Nds7	d	153bp	A/J, AKR/J, BALB/cJ, DBA/2J, NON/ShiLt
	e	163bp	B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac, SPRET/EiJ
	f	181bp	CAST/EiJ

J:19832 Kuramoto T, et al., Int Immunol. 1994 Jul;6(7):991-4

Notes: ALY is a partially inbred strain carrying the mutation aly/aly.

Endonuclease	Gene	Allele	Fragments	Strains
	D11Nds7	a	not given	ALY
	D11Nds7	m	not given	MSM/Ms

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:19832 Kuramoto T, et al., The alymphoplasia (aly) mutation co-segregates with the intercellular adhesion molecule-2 (lcam-2) on mouse chromosome 11. Int Immunol. 1994 Jul;6(7):991-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24