T14 Primer Detail MGI Mouse MGI:733

T14 Primer Detail

Name

T14
Primer 1 Sequence

CCTTTCTGAAAGTATTAAGAGT
Primer 2 Sequence

ACAACCATCTGCATATCCAGC
ID

MGI:733

D11Nds9	DNA segment, Chr 11, Nuffield Department of Surgery 9
Il5	interleukin 5

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D11Nds9	e	306bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
	f	309bp	CAST/EiJ
	i	302bp	NOD/MrkTac, NON/ShiLt

J:19832 Kuramoto T, et al., Int Immunol. 1994 Jul;6(7):991-4

Notes: ALY is a partially inbred strain carrying the mutation aly/aly.

Endonuclease	Gene	Allele	Fragments	Strains
	D11Nds9	a	not given	ALY
	D11Nds9	m	not given	MSM/Ms

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Endonuclease	Gene	Allele	Fragments	Strains
	D11Nds9	a	larger	AKR/J, C57BL/J, SM/J
	D11Nds9	l	smaller	LG/J

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:19832 Kuramoto T, et al., The alymphoplasia (aly) mutation co-segregates with the intercellular adhesion molecule-2 (lcam-2) on mouse chromosome 11. Int Immunol. 1994 Jul;6(7):991-4

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24