D11Bhm148-pA, D11Bhm148-pB Primer Detail MGI Mouse MGI:7412

About Help FAQ

D11Bhm148-pA, D11Bhm148-pB Primer Detail

Name

D11Bhm148-pA, D11Bhm148-pB
Primer 1 Sequence

AGGGGAAGTCCTGTATGGACA
Primer 2 Sequence

ACCAACCTCGATAGAGCCATC
ID

MGI:7412

D11Bhm148

DNA segment, Chr 11, Boehm 148

J:25181 Nehls M, et al., Mamm Genome. 1995 May;6(5):321-31

Gene	Allele	Fragments	Strains
D11Bhm148	b	97bp	C57BL/6
	c	107bp	129/Sv, AKR/J, BALB/c, C3H/He
	s	113bp	M. spretus

J:25181 Nehls M, et al., YAC/P1 contigs defining the location of 56 microsatellite markers and several genes across a 3.4-cM interval on mouse chromosome 11. Mamm Genome. 1995 May;6(5):321-31

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13