T10 Primer Detail MGI Mouse MGI:749

T10 Primer Detail

Name

T10
Primer 1 Sequence

TGCTGGCTAGGAATAAACAGA
Primer 2 Sequence

AGGGAATTCATGTTCAGGATA
ID

MGI:749

D14Nds1	DNA segment, Chr 14, Nuffield Department of Surgery 1
Plau	plasminogen activator, urokinase

J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47

Gene	Allele	Fragments	Strains
D14Nds1	e	182bp	A/J, AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	f	201bp	CAST/EiJ, DBA/2J
	j	188bp	NOD/MrkTac
	s	190bp	BALB/cJ, LP/J, NON/ShiLt, SPRET/EiJ

J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4

Endonuclease	Gene	Allele	Fragments	Strains
	D14Nds1	a	larger	AKR/J, SM/J
	D14Nds1	b	smaller	C57BL/J, LG/J

J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47

J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24