About   Help   FAQ
T10 Primer Detail
Primers
  • Name
    T10
  • Primer 1 Sequence
    TGCTGGCTAGGAATAAACAGA
  • Primer 2 Sequence
    AGGGAATTCATGTTCAGGATA
  • ID
    MGI:749
Genes
D14Nds1 DNA segment, Chr 14, Nuffield Department of Surgery 1
Plau plasminogen activator, urokinase
Polymorphisms
J:1066 Dietrich W, et al., Genetics. 1992 Jun;131(2):423-47
Endonuclease Gene Allele Fragments Strains
D14Nds1 e 182bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J
f 201bp CAST/EiJ, DBA/2J
j 188bp NOD/MrkTac
s 190bp BALB/cJ, LP/J, NON/ShiLt, SPRET/EiJ
J:26136 Routman EJ, et al., Mamm Genome. 1995 Jun;6(6):401-4
Endonuclease Gene Allele Fragments Strains
D14Nds1 a larger AKR/J, SM/J
b smaller C57BL/J, LG/J
References
J:1066 Dietrich W, et al., A genetic map of the mouse suitable for typing intraspecific crosses. Genetics. 1992 Jun;131(2):423-47
J:26136 Routman EJ, et al., Polymorphism for PCR-analyzed microsatellites between the inbred mouse strains LG and SM. Mamm Genome. 1995 Jun;6(6):401-4
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory