10F, 10R Primer Detail MGI Mouse MGI:7770

About Help FAQ

10F, 10R Primer Detail

Name

10F, 10R
Primer 1 Sequence

CAGCATTAAGCCTCAAGAAT
Primer 2 Sequence

GTCACAACCCAAGGTGTTTA
ID

MGI:7770
Region Covered

3' untranslated region of exon 5 of H2-Ea
Product Size

250bp

H2-Ea	histocompatibility 2, class II antigen E alpha
D17Rua10	DNA segment, Chr 17, Rutgers University 10

J:32563 Khambata S, et al., Genome Res. 1996 Mar;6(3):195-201

Gene	Allele	Fragments	Strains
D17Rua10	a	not given	B10.F-H2^pb1/(13R)J
	b	not given	C57BL/10
	c	not given	B10.S-H2^t4/(9R)/J
	d	not given	A.TL-H2^t1

J:32563 Khambata S, et al., Ea recombinational hot spot in the mouse major histocompatibility complex maps to the fourth intron of the Ea gene. Genome Res. 1996 Mar;6(3):195-201

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13