D17Dgm4-pA, D17Dgm4-pB Primer Detail MGI Mouse MGI:7776

About Help FAQ

D17Dgm4-pA, D17Dgm4-pB Primer Detail

Name

D17Dgm4-pA, D17Dgm4-pB
Primer 1 Sequence

GTAGGTACTCTACCACCTG
Primer 2 Sequence

CTCAGATCAGTAAGTCACTG
ID

MGI:7776

D17Dgm4	DNA segment, Chr 17, Department of Geriatric Medicine 4
Psmb9	proteasome (prosome, macropain) subunit, beta type 9 (large multifunctional peptidase 2)

J:29073 Ikegami H, et al., J Clin Invest. 1995 Oct;96(4):1936-42

Gene	Allele	Fragments	Strains
D17Dgm4	b	0.122kb	C57BL/6, CTS/Shi, NOD/Shi
	c	0.134kb	BALB/c
	h	0.124kb	C3H/He
	n	0.112kb	NON/Shi

J:29073 Ikegami H, et al., Identification of a new susceptibility locus for insulin-dependent diabetes mellitus by ancestral haplotype congenic mapping. J Clin Invest. 1995 Oct;96(4):1936-42

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13