JS139, JS134 Primer Detail MGI Mouse MGI:802

JS139, JS134 Primer Detail

Name

JS139, JS134
Primer 1 Sequence

GTTTACCACTTAGAACACAG
Primer 2 Sequence

CTTCTGGAGTGTCTGAAGAC
ID

MGI:802

Iap3ra1	intracisternal A-type particle, U3 region, SINE repeat a-1
Iap3ra10	intracisternal A-type particle, U3 region, SINE repeat a-10
Iap3ra11	intracisternal A-type particle, U3 region, SINE repeat a-11
Iap3ra12	intracisternal A-type particle, U3 region, SINE repeat a-12
Iap3ra13	intracisternal A-type particle, U3 region, SINE repeat a-13
Iap3ra14	intracisternal A-type particle, U3 region, SINE repeat a-14
Iap3ra15	intracisternal A-type particle, U3 region, SINE repeat a-15
Iap3ra16	intracisternal A-type particle, U3 region, SINE repeat a-16
Iap3ra17	intracisternal A-type particle, U3 region, SINE repeat a-17
Iap3ra18	intracisternal A-type particle, U3 region, SINE repeat a-18
Iap3ra2	intracisternal A-type particle, U3 region, SINE repeat a-2
Iap3ra3	intracisternal A-type particle, U3 region, SINE repeat a-3
Iap3ra4	intracisternal A-type particle, U3 region, SINE repeat a-4
Iap3ra5	intracisternal A-type particle, U3 region, SINE repeat a-5
Iap3ra6	intracisternal A-type particle, U3 region, SINE repeat a-6
Iap3ra7	intracisternal A-type particle, U3 region, SINE repeat a-7
Iap3ra8	intracisternal A-type particle, U3 region, SINE repeat a-8
Iap3ra9	intracisternal A-type particle, U3 region, SINE repeat a-9

J:21511 Kaushik N, et al., Mamm Genome. 1994 Nov;5(11):688-95

Gene	Allele	Fragments	Strains
Iap3ra1	b	127bp	C57BL/6J
Iap3ra1	s	absent	C3H/HeJ, M. spretus
Iap3ra2	b	133bp	C3H/HeJ
Iap3ra2	s	absent	C57BL/6J, M. spretus
Iap3ra3	b	145bp	C57BL/6J
Iap3ra3	s	absent	C3H/HeJ, M. spretus
Iap3ra4	b	239bp	C3H/HeJ
Iap3ra4	s	absent	C57BL/6J, M. spretus
Iap3ra5	b	285bp	C3H/HeJ
Iap3ra5	s	absent	C57BL/6J, M. spretus
Iap3ra6	b	291bp	C57BL/6J
Iap3ra6	s	absent	C3H/HeJ, M. spretus
Iap3ra7	b	400bp	C3H/HeJ
Iap3ra7	s	absent	C57BL/6J, M. spretus
Iap3ra8	b	412bp	C57BL/6J
Iap3ra8	s	absent	C3H/HeJ, M. spretus
Iap3ra9	b	600bp	C57BL/6J
Iap3ra9	s	absent	C3H/HeJ, M. spretus
Iap3ra10	b	1000bp	C3H/HeJ
Iap3ra10	s	absent	C57BL/6J, M. spretus
Iap3ra11	b	182bp	STS/A
Iap3ra11	s	absent	BALB/cJ, M. spretus
Iap3ra12	b	226bp	STS/A
Iap3ra12	s	absent	BALB/cJ, M. spretus
Iap3ra13	b	231bp	BALB/cJ
Iap3ra13	s	absent	M. spretus, STS/A
Iap3ra14	b	239bp	STS/A
Iap3ra14	s	absent	BALB/cJ, M. spretus
Iap3ra15	b	293bp	STS/A
Iap3ra15	s	absent	BALB/cJ, M. spretus
Iap3ra16	b	400bp	BALB/cJ
Iap3ra16	s	absent	M. spretus, STS/A
Iap3ra17	b	413bp	STS/A
Iap3ra17	s	absent	BALB/cJ, M. spretus
Iap3ra18	b	600bp	BALB/cJ
Iap3ra18	s	absent	M. spretus, STS/A

J:21511 Kaushik N, et al., Intracisternal A-type particle elements as genetic markers: detection by repeat element viral element amplified locus-PCR. Mamm Genome. 1994 Nov;5(11):688-95

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24