About   Help   FAQ
JS139, JS135 Primer Detail
Primers
  • Name
    JS139, JS135
  • Primer 1 Sequence
    GTTTACCACTTAGAACACAG
  • Primer 2 Sequence
    GACTGCTCTTCCGAAGGTCC
  • ID
    MGI:803
Genes
Iap3rb1 intracisternal A-type particle, U3 region, SINE repeat b-1
Iap3rb10 intracisternal A-type particle, U3 region, SINE repeat b-10
Iap3rb11 intracisternal A-type particle, U3 region, SINE repeat b-11
Iap3rb12 intracisternal A-type particle, U3 region, SINE repeat b-12
Iap3rb13 intracisternal A-type particle, U3 region, SINE repeat b-13
Iap3rb14 intracisternal A-type particle, U3 region, SINE repeat b-14
Iap3rb15 intracisternal A-type particle, U3 region, SINE repeat b-15
Iap3rb16 intracisternal A-type particle, U3 region, SINE repeat b-16
Iap3rb17 intracisternal A-type particle, U3 region, SINE repeat b-17
Iap3rb18 intracisternal A-type particle, U3 region, SINE repeat b-18
Iap3rb19 intracisternal A-type particle, U3 region, SINE repeat b-19
Iap3rb2 intracisternal A-type particle, U3 region, SINE repeat b-2
Iap3rb3 intracisternal A-type particle, U3 region, SINE repeat b-3
Iap3rb4 intracisternal A-type particle, U3 region, SINE repeat b-4
Iap3rb5 intracisternal A-type particle, U3 region, SINE repeat b-5
Iap3rb6 intracisternal A-type particle, U3 region, SINE repeat b-6
Iap3rb7 intracisternal A-type particle, U3 region, SINE repeat b-7
Iap3rb8 intracisternal A-type particle, U3 region, SINE repeat b-8
Iap3rb9 intracisternal A-type particle, U3 region, SINE repeat b-9
Polymorphisms
J:21511 Kaushik N, et al., Mamm Genome. 1994 Nov;5(11):688-95
Endonuclease Gene Allele Fragments Strains
Iap3rb1 b 109bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rb2 b 114bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rb3 b 126bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rb4 b 127bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rb5 b 131bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rb6 b 168bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rb7 b 183bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rb8 b 211bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rb9 b 250bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rb10 b 127bp STS/A
s absent BALB/cJ, M. spretus
Iap3rb11 b 144bp STS/A
s absent BALB/cJ, M. spretus
Iap3rb12 b 405bp STS/A
s absent BALB/cJ, M. spretus
Iap3rb13 b 410bp BALB/cJ
s absent M. spretus, STS/A
Iap3rb14 b 414bp BALB/cJ
s absent M. spretus, STS/A
Iap3rb15 b 470bp STS/A
s absent BALB/cJ, M. spretus
Iap3rb16 b 473bp BALB/cJ
s absent M. spretus, STS/A
Iap3rb17 b 495bp STS/A
s absent BALB/cJ, M. spretus
Iap3rb18 b 800bp BALB/cJ
s absent M. spretus, STS/A
Iap3rb19 b 950bp BALB/cJ
s absent M. spretus, STS/A
References
J:21511 Kaushik N, et al., Intracisternal A-type particle elements as genetic markers: detection by repeat element viral element amplified locus-PCR. Mamm Genome. 1994 Nov;5(11):688-95
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/19/2024
MGI 6.24 		The Jackson Laboratory