About   Help   FAQ
JS139, JS136 Primer Detail
Primers
  • Name
    JS139, JS136
  • Primer 1 Sequence
    GTTTACCACTTAGAACACAG
  • Primer 2 Sequence
    CTGGAACTCACTCTGAAGAC
  • ID
    MGI:804
Genes
Iap3rc1 intracisternal A-type particle, U3 region, SINE repeat c-1
Iap3rc10 intracisternal A-type particle, U3 region, SINE repeat c-10
Iap3rc11 intracisternal A-type particle, U3 region, SINE repeat c-11
Iap3rc12 intracisternal A-type particle, U3 region, SINE repeat c-12
Iap3rc13 intracisternal A-type particle, U3 region, SINE repeat c-13
Iap3rc14 intracisternal A-type particle, U3 region, SINE repeat c-14
Iap3rc15 intracisternal A-type particle, U3 region, SINE repeat c-15
Iap3rc16 intracisternal A-type particle, U3 region, SINE repeat c-16
Iap3rc17 intracisternal A-type particle, U3 region, SINE repeat c-17
Iap3rc18 intracisternal A-type particle, U3 region, SINE repeat c-18
Iap3rc19 intracisternal A-type particle, U3 region, SINE repeat c-19
Iap3rc2 intracisternal A-type particle, U3 region, SINE repeat c-2
Iap3rc20 intracisternal A-type particle, U3 region, SINE repeat c-20
Iap3rc21 intracisternal A-type particle, U3 region, SINE repeat c-21
Iap3rc22 intracisternal A-type particle, U3 region, SINE repeat c-22
Iap3rc23 intracisternal A-type particle, U3 region, SINE repeat c-23
Iap3rc24 intracisternal A-type particle, U3 region, SINE repeat c-24
Iap3rc25 intracisternal A-type particle, U3 region, SINE repeat c-25
Iap3rc26 intracisternal A-type particle, U3 region, SINE repeat c-26
Iap3rc27 intracisternal A-type particle, U3 region, SINE repeat c-27
Iap3rc28 intracisternal A-type particle, U3 region, SINE repeat c-28
Iap3rc3 intracisternal A-type particle, U3 region, SINE repeat c-3
Iap3rc4 intracisternal A-type particle, U3 region, SINE repeat c-4
Iap3rc5 intracisternal A-type particle, U3 region, SINE repeat c-5
Iap3rc6 intracisternal A-type particle, U3 region, SINE repeat c-6
Iap3rc7 intracisternal A-type particle, U3 region, SINE repeat c-7
Iap3rc8 intracisternal A-type particle, U3 region, SINE repeat c-8
Iap3rc9 intracisternal A-type particle, U3 region, SINE repeat c-9
Polymorphisms
J:21511 Kaushik N, et al., Mamm Genome. 1994 Nov;5(11):688-95
Endonuclease Gene Allele Fragments Strains
Iap3rc1 b 132bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc2 b 143bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rc3 b 159bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc4 b 178bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc5 b 207bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rc6 b 265bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc7 b 283bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rc8 b 297bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc9 b 360bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc10 b 365bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc11 b 430bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rc12 b 500bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap3rc13 b 505bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc14 b 1100bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap3rc15 b 114bp BALB/cJ
s absent M. spretus, STS/A
Iap3rc16 b 142bp BALB/cJ
s absent M. spretus, STS/A
Iap3rc17 b 244bp STS/A
s absent BALB/cJ, M. spretus
Iap3rc18 b 265bp STS/A
s absent BALB/cJ, M. spretus
Iap3rc19 b 299bp STS/A
s absent BALB/cJ, M. spretus
Iap3rc20 b 430bp BALB/cJ
s absent M. spretus, STS/A
Iap3rc21 b 440bp BALB/cJ
s absent M. spretus, STS/A
Iap3rc22 b 445bp STS/A
s absent BALB/cJ, M. spretus
Iap3rc23 b 510bp STS/A
s absent BALB/cJ, M. spretus
Iap3rc24 b 550bp STS/A
s absent BALB/cJ, M. spretus
Iap3rc25 b 600bp BALB/cJ
s absent M. spretus, STS/A
Iap3rc26 b 650bp BALB/cJ
s absent M. spretus, STS/A
Iap3rc27 b 900bp STS/A
s absent BALB/cJ, M. spretus
Iap3rc28 b 1120bp STS/A
s absent BALB/cJ, M. spretus
References
J:21511 Kaushik N, et al., Intracisternal A-type particle elements as genetic markers: detection by repeat element viral element amplified locus-PCR. Mamm Genome. 1994 Nov;5(11):688-95
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/12/2024
MGI 6.24 		The Jackson Laboratory