JS140, JS134 Primer Detail MGI Mouse MGI:805

JS140, JS134 Primer Detail

Name

JS140, JS134
Primer 1 Sequence

TTTGCCGCAGAAGATTCTGG
Primer 2 Sequence

CTTCTGGAGTGTCTGAAGAC
ID

MGI:805

Iap5ra1	intracisternal A-type particle, U5 region, SINE repeat a-1
Iap5ra10	intracisternal A-type particle, U5 region, SINE repeat a-10
Iap5ra11	intracisternal A-type particle, U5 region, SINE repeat a-11
Iap5ra12	intracisternal A-type particle, U5 region, SINE repeat a-12
Iap5ra13	intracisternal A-type particle, U5 region, SINE repeat a-13
Iap5ra2	intracisternal A-type particle, U5 region, SINE repeat a-2
Iap5ra3	intracisternal A-type particle, U5 region, SINE repeat a-3
Iap5ra4	intracisternal A-type particle, U5 region, SINE repeat a-4
Iap5ra5	intracisternal A-type particle, U5 region, SINE repeat a-5
Iap5ra6	intracisternal A-type particle, U5 region, SINE repeat a-6
Iap5ra7	intracisternal A-type particle, U5 region, SINE repeat a-7
Iap5ra8	intracisternal A-type particle, U5 region, SINE repeat a-8
Iap5ra9	intracisternal A-type particle, U5 region, SINE repeat a-9

J:21511 Kaushik N, et al., Mamm Genome. 1994 Nov;5(11):688-95

Gene	Allele	Fragments	Strains
Iap5ra1	b	120bp	C3H/HeJ
Iap5ra1	s	absent	C57BL/6J, M. spretus
Iap5ra2	b	129bp	C3H/HeJ
Iap5ra2	s	absent	C57BL/6J, M. spretus
Iap5ra3	b	181bp	C57BL/6J
Iap5ra3	s	absent	C3H/HeJ, M. spretus
Iap5ra4	b	186bp	C3H/HeJ
Iap5ra4	s	absent	C57BL/6J, M. spretus
Iap5ra5	b	239bp	C57BL/6J
Iap5ra5	s	absent	C3H/HeJ, M. spretus
Iap5ra6	b	284bp	C57BL/6J
Iap5ra6	s	absent	C3H/HeJ, M. spretus
Iap5ra7	b	600bp	C3H/HeJ
Iap5ra7	s	absent	C57BL/6J, M. spretus
Iap5ra8	b	129bp	BALB/cJ
Iap5ra8	s	absent	M. spretus, STS/A
Iap5ra9	b	181bp	BALB/cJ
Iap5ra9	s	absent	M. spretus, STS/A
Iap5ra10	b	186bp	BALB/cJ
Iap5ra10	s	absent	M. spretus, STS/A
Iap5ra11	b	261bp	BALB/cJ
Iap5ra11	s	absent	M. spretus, STS/A
Iap5ra12	b	264bp	STS/A
Iap5ra12	s	absent	BALB/cJ, M. spretus
Iap5ra13	b	296bp	STS/A
Iap5ra13	s	absent	BALB/cJ, M. spretus

J:21511 Kaushik N, et al., Intracisternal A-type particle elements as genetic markers: detection by repeat element viral element amplified locus-PCR. Mamm Genome. 1994 Nov;5(11):688-95

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13