About   Help   FAQ
JS140, JS134 Primer Detail
Primers
  • Name
    JS140, JS134
  • Primer 1 Sequence
    TTTGCCGCAGAAGATTCTGG
  • Primer 2 Sequence
    CTTCTGGAGTGTCTGAAGAC
  • ID
    MGI:805
Genes
Iap5ra1 intracisternal A-type particle, U5 region, SINE repeat a-1
Iap5ra10 intracisternal A-type particle, U5 region, SINE repeat a-10
Iap5ra11 intracisternal A-type particle, U5 region, SINE repeat a-11
Iap5ra12 intracisternal A-type particle, U5 region, SINE repeat a-12
Iap5ra13 intracisternal A-type particle, U5 region, SINE repeat a-13
Iap5ra2 intracisternal A-type particle, U5 region, SINE repeat a-2
Iap5ra3 intracisternal A-type particle, U5 region, SINE repeat a-3
Iap5ra4 intracisternal A-type particle, U5 region, SINE repeat a-4
Iap5ra5 intracisternal A-type particle, U5 region, SINE repeat a-5
Iap5ra6 intracisternal A-type particle, U5 region, SINE repeat a-6
Iap5ra7 intracisternal A-type particle, U5 region, SINE repeat a-7
Iap5ra8 intracisternal A-type particle, U5 region, SINE repeat a-8
Iap5ra9 intracisternal A-type particle, U5 region, SINE repeat a-9
Polymorphisms
J:21511 Kaushik N, et al., Mamm Genome. 1994 Nov;5(11):688-95
Endonuclease Gene Allele Fragments Strains
Iap5ra1 b 120bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5ra2 b 129bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5ra3 b 181bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5ra4 b 186bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5ra5 b 239bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5ra6 b 284bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5ra7 b 600bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5ra8 b 129bp BALB/cJ
s absent M. spretus, STS/A
Iap5ra9 b 181bp BALB/cJ
s absent M. spretus, STS/A
Iap5ra10 b 186bp BALB/cJ
s absent M. spretus, STS/A
Iap5ra11 b 261bp BALB/cJ
s absent M. spretus, STS/A
Iap5ra12 b 264bp STS/A
s absent BALB/cJ, M. spretus
Iap5ra13 b 296bp STS/A
s absent BALB/cJ, M. spretus
References
J:21511 Kaushik N, et al., Intracisternal A-type particle elements as genetic markers: detection by repeat element viral element amplified locus-PCR. Mamm Genome. 1994 Nov;5(11):688-95
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory