About   Help   FAQ
JS140, JS136 Primer Detail
Primers
  • Name
    JS140, JS136
  • Primer 1 Sequence
    TTTGCCGCAGAAGATTCTGG
  • Primer 2 Sequence
    CTGGAACTCACTCTGAAGAC
  • ID
    MGI:807
Genes
Iap5rc1 intracisternal A-type particle, U5 region, SINE repeat c-1
Iap5rc10 intracisternal A-type particle, U5 region, SINE repeat c-10
Iap5rc11 intracisternal A-type particle, U5 region, SINE repeat c-11
Iap5rc12 intracisternal A-type particle, U5 region, SINE repeat c-12
Iap5rc13 intracisternal A-type particle, U5 region, SINE repeat c-13
Iap5rc14 intracisternal A-type particle, U5 region, SINE repeat c-14
Iap5rc15 intracisternal A-type particle, U5 region, SINE repeat c-15
Iap5rc16 intracisternal A-type particle, U5 region, SINE repeat c-16
Iap5rc17 intracisternal A-type particle, U5 region, SINE repeat c-17
Iap5rc18 intracisternal A-type particle, U5 region, SINE repeat c-18
Iap5rc19 intracisternal A-type particle, U5 region, SINE repeat c-19
Iap5rc2 intracisternal A-type particle, U5 region, SINE repeat c-2
Iap5rc20 intracisternal A-type particle, U5 region, SINE repeat c-20
Iap5rc21 intracisternal A-type particle, U5 region, SINE repeat c-21
Iap5rc22 intracisternal A-type particle, U5 region, SINE repeat c-22
Iap5rc3 intracisternal A-type particle, U5 region, SINE repeat c-3
Iap5rc4 intracisternal A-type particle, U5 region, SINE repeat c-4
Iap5rc5 intracisternal A-type particle, U5 region, SINE repeat c-5
Iap5rc6 intracisternal A-type particle, U5 region, SINE repeat c-6
Iap5rc7 intracisternal A-type particle, U5 region, SINE repeat c-7
Iap5rc8 intracisternal A-type particle, U5 region, SINE repeat c-8
Iap5rc9 intracisternal A-type particle, U5 region, SINE repeat c-9
Polymorphisms
J:21511 Kaushik N, et al., Mamm Genome. 1994 Nov;5(11):688-95
Endonuclease Gene Allele Fragments Strains
Iap5rc1 b 121bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rc2 b 124bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rc3 b 172bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rc4 b 212bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rc5 b 237bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rc6 b 257bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rc7 b 281bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rc8 b 284bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rc9 b 293bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rc10 b 297bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rc11 b 325bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rc12 b 371bp C57BL/6J
s absent C3H/HeJ, M. spretus
Iap5rc13 b 381bp C3H/HeJ
s absent C57BL/6J, M. spretus
Iap5rc14 b 182bp STS/A
s absent BALB/cJ, M. spretus
Iap5rc15 b 184bp BALB/cJ
s absent M. spretus, STS/A
Iap5rc16 b 212bp BALB/cJ
s absent M. spretus, STS/A
Iap5rc17 b 222bp BALB/cJ
s absent M. spretus, STS/A
Iap5rc18 b 281bp BALB/cJ
s absent M. spretus, STS/A
Iap5rc19 b 284bp STS/A
s absent BALB/cJ, M. spretus
Iap5rc20 b 297bp BALB/cJ
s absent M. spretus, STS/A
Iap5rc21 b 325bp STS/A
s absent BALB/cJ, M. spretus
Iap5rc22 b 430bp BALB/cJ
s absent M. spretus, STS/A
References
J:21511 Kaushik N, et al., Intracisternal A-type particle elements as genetic markers: detection by repeat element viral element amplified locus-PCR. Mamm Genome. 1994 Nov;5(11):688-95
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/05/2024
MGI 6.24 		The Jackson Laboratory