About   Help   FAQ
Lck-pA, Lck-pB Primer Detail
Primers
  • Name
    Lck-pA, Lck-pB
  • Primer 1 Sequence
    GCAGATGGAATTCCTGTGCCA
  • Primer 2 Sequence
    ACACACAGAGACATGAGATTGGAT
  • ID
    MGI:827
  • Product Size
    339bp
Genes
Lck lymphocyte protein tyrosine kinase
Polymorphisms
J:3351 Todd JA, et al., Nature. 1991 Jun 13;351(6327):542-7
Endonuclease Gene Allele Fragments Strains
HaeIII Lck b 260bp B10.H2g7
n 200bp NOD
J:20039 Fiedorek FT Jr, et al., Mamm Genome. 1994 Aug;5(8):479-85
Notes: Electrophoretic variants distinguishing the two strains were identified using single stranded conformation polymorphic analysis.
Endonuclease Gene Allele Fragments Strains
Lck b not given BKS.D-Dock7m
c not given CZECHII
References
J:3351 Todd JA, et al., Genetic analysis of autoimmune type 1 diabetes mellitus in mice [see comments]. Nature. 1991 Jun 13;351(6327):542-7
J:20039 Fiedorek FT Jr, et al., Mapping of PCR-based markers for mouse chromosome 4 on a backcross penetrant for the misty (m) mutation. Mamm Genome. 1994 Aug;5(8):479-85

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/05/2024
MGI 6.24
The Jackson Laboratory