b24-1 Primer Detail MGI Mouse MGI:8546

About Help FAQ

b24-1 Primer Detail

Name

b24-1
Primer 1 Sequence

TTTTTAAATTATCAAATAGAAGAG
Primer 2 Sequence

TACAGATTGAGTTTGGCCCC
ID

MGI:8546

D13Die21

DNA segment, Chr 13, Dietrich 21

J:37707 Scharf JM, et al., Genomics. 1996 Dec 15;38(3):405-17

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Die21	a	not given	A/J
		b	123bp	C57BL/6J
		s	not given	M. spretus
		x	not given	129

J:37707 Scharf JM, et al., The mouse region syntenic for human spinal muscular atrophy lies within the Lgn1 critical interval and contains multiple copies of Naip exon 5. Genomics. 1996 Dec 15;38(3):405-17

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24