55-2 Primer Detail MGI Mouse MGI:8561

55-2 Primer Detail

Name

55-2
Primer 1 Sequence

GATCTCTCCCAGCAGTATTTGG
Primer 2 Sequence

GCTCAGGAAAAAAAATGGAGG
ID

MGI:8561
Other IDs

55-2 (BROAD)

D13Mit37b	DNA segment, Chr 13, Massachusetts Institute of Technology 37b
D13Mit37a	DNA segment, Chr 13, Massachusetts Institute of Technology 37a

J:37707 Scharf JM, et al., Genomics. 1996 Dec 15;38(3):405-17

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit37a	a	240bp	A/J
		b	240bp	C57BL/6J
		s	240bp	M. spretus
		x	240bp	129
Not Specified	D13Mit37b	a	not given	A/J
		b	240bp	C57BL/6J
		s	not given	M. spretus
		x	not given	129

J:37707 Scharf JM, et al., The mouse region syntenic for human spinal muscular atrophy lies within the Lgn1 critical interval and contains multiple copies of Naip exon 5. Genomics. 1996 Dec 15;38(3):405-17

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24