About   Help   FAQ
Ant1-pC, Ant1-pD Primer Detail
Primers
  • Name
    Ant1-pC, Ant1-pD
  • Primer 1 Sequence
    GCTGCCAGACCCCAAGAATG
  • Primer 2 Sequence
    GTCCCCGTGTACATAATATC
  • ID
    MGI:8587
  • Synonyms
    Ant1-pA1, Ant1-pB1
Genes
Slc25a4 solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4
Polymorphisms
J:39602 Grewal PK, et al., Mamm Genome. 1997 May;8(5):383-4
Endonuclease Gene Allele Fragments Strains
HaeIII Slc25a4 b 0.250kb C57BL/6J
s 0.400kb M. spretus
J:48971 Grewal PK, et al., Mamm Genome. 1998 Aug;9(8):603-7
Endonuclease Gene Allele Fragments Strains
HaeIII Slc25a4 b ~250bp C57BL/6J
s ~400bp SPR
References
J:39602 Grewal PK, et al., Fath, the murine homolog of the Drosophila fat tumor suppressor gene, maps to chromosome 8. Mamm Genome. 1997 May;8(5):383-4
J:48971 Grewal PK, et al., High-resolution mapping of mouse chromosome 8 identifies an evolutionary chromosomal breakpoint. Mamm Genome. 1998 Aug;9(8):603-7

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory