oligo 2335, oligo 2592 Primer Detail MGI Mouse MGI:90

About Help FAQ

oligo 2335, oligo 2592 Primer Detail

Name

oligo 2335, oligo 2592
Primer 1 Sequence

CCCTCGAGGGCATGTACAGCATGCAGCT
Primer 2 Sequence

GGGGAGTTTCAGGTTCCTGT
ID

MGI:90
Product Size

223bp

Il2

interleukin 2

J:3450 Matesanz F, et al., Biochim Biophys Acta. 1992 Oct 20;1132(3):335-6

Notes: cDNA was amplified via symmetric PCR with the indicated primers. Fragments were inserted into pBluescript and sequenced. Strains were arranged into allele groupings based on presence (b) or absence (a) of a 12bp sequence in the ~0.22kb fragment.

Endonuclease	Gene	Allele	Fragments	Strains
	Il2	a	~0.22kb	RF/J
	Il2	b	~0.22kb	B10.BR-H2^k, BALB/c, C57BL/6

J:3450 Matesanz F, et al., A new cDNA sequence for the murine interleukin-2 gene. Biochim Biophys Acta. 1992 Oct 20;1132(3):335-6

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24